DNA microarrays

DNA microarrays

4.11 - 1251 ratings - Source

This manual, designed to extend and to complement the information in the best-selling Molecular Cloning, is a synthesis of the expertise and experience of more than 30 contributors--all innovators in a fast-moving field. DNA Microarrays provides authoritative, detailed instruction on the design, construction, and applications of microarrays, as well as comprehensive descriptions of the software tools and strategies required for analysis of images and data.a molecular cloning manual David Bowtell, Joseph Sambrook ... LT 1 54 AGATTGCGTCCATCAGCCAGAGTGT LT155 CGAGTCACTCAGCGCACTGGTTAAG LT156 CAGGAGGAGTCCGGTATGGCTGAAC LT157anbsp;...

Title:DNA microarrays
Author: David Bowtell, Joseph Sambrook
Publisher:Cold Spring Harbor Laboratory Pr - 2003

You must register with us as either a Registered User before you can Download this Book. You'll be greeted by a simple sign-up page.

Once you have finished the sign-up process, you will be redirected to your download Book page.

How it works:
  • 1. Register a free 1 month Trial Account.
  • 2. Download as many books as you like (Personal use)
  • 3. Cancel the membership at any time if not satisfied.

Click button below to register and download Ebook
Privacy Policy | Contact | DMCA